Skip to main content

Table 1 Examples of three types of DNA fragments.

From: Preprocessing differential methylation hybridization microarray data

Before MSRE digestion

After MSRE digestion

Probe signals

1). No MSRE cutting sites ATCGTCCAGCCGATTTAAACCCGTATCGTA

Not being restricted/cut, saved for hybridization

Contribute to the final probe signals

2). All MSRE cutting sites are methylated ATCGC m G CCACCGATTTC m CGG TACGC m G GGAA

Not being restricted/cut, saved for hybridization

Contribute to the final probe signals

3) At least one MSRE cutting site is not methylated ATCGCG CCACCGATTTC m CGG TACGCG GGAAA

Being cut and will not be hybridized onto the array

Do not contribute to the final probe signals

  1. The first column contains examples of three different types of DNA fragments before they are digested by MSREs. In this column, all MSREs are underlined. "CmG" means there is methylation at this CG site, otherwise, "CG" simply means a regular CG site and it has not been methylated. The second column contains the results after MSREs digestion. The third column explains whether a type of DNA fragments can contribute to the final signals of the probe it covers.